SlideShare ist ein Scribd-Unternehmen logo
1 von 75
Downloaden Sie, um offline zu lesen
We have seen that there is abundant evidence for the common descent of human beings and the rest of the living world.,[object Object],In Darwin’s time very little was known of the steps or intermediate stages that led to us. ,[object Object],This has changed dramatically in the last 150 years and now we have a wealth of data that enables us to reconstruct much of our origins.,[object Object]
Human beings have always pondered over how they came into existence. This has given rise to a wide variety of speculation and several beautiful stories.,[object Object],The Judeo-Christian tradition has the myth of Adam and Eve and the garden of Eden.,[object Object]
In ancient Indian mythology, Brahma created the world. He along with Siva the destroyer and Vishnu the preserver formed the Hindu trinity of Gods.,[object Object],However, moving beyond mythologies science has pieced together a far more interesting story that is still in the process of development.,[object Object]
The scientific history of the human race would not have been possible but for many great explorer-scientists who combined their love of adventure with their immense scientific curiosity.,[object Object],Though Darwin had surmised that evolution of hominids was in Africa, very soon the majority opinion shifted to Asia as the most likely place for early hominid evolution.,[object Object],Eugene Dubois gave up a prestigious academic career to go looking for the so called ‘missing link’ between apes and humans, in the remote islands of the Malay archipelago.,[object Object],He was rewarded by the find of what came to be known as the Java man in Indonesia. We now recognize this as the ‘Homo erectus’.,[object Object]
The focus shifted back to Africa in the 20th century.,[object Object],Much of the fossil evidence for the current view on human evolution has come from the great rift valley in Africa spanning from Ethiopia to East Africa.,[object Object]
The husband and wife team of Louis Leakey and Mary Leakey were pioneers in the exploration for human origins in Africa.,[object Object]
Most of the studies of the Leakeys were done in the Olduvai gorge and the nearby Laetoli in Tanzania.,[object Object]
The Olduvai gorge is a steep-sided ravine from where  fossil remains of human ancestors have been found from as long as 2.5 million years ago. It is also a site from which very old stone tools dating to about the same time were unearthed.,[object Object],These tools called Oldowan tools indicate that our hominid ancestors started using tools from as early as 2.5 million years ago.,[object Object]
Richard Leakey (son of Louis and Mary) and Donald Johanson (right). Richard’s digs near the Lake Turkana in Kenya and Johanson’s in the Afar region of Ethiopia helped discover landmark fossils.,[object Object]
A team of researchers excavating in northern Chad unearthed in 2002 the well-preserved skull and other fossilized remains of what they believe was an early human precursor, that lived six to seven million years ago. It is probably  the oldest known ancestor of humans. Named Sahelanthropustchadensis, it is believed to have walked upright, but not all scientists agree on this.,[object Object]
The term ‘missing link’ is often misinterpreted by those who oppose the theory of evolution, particularly the creationists. ,[object Object],It is understandable to talk of a common ancestor, in this case a now extinct ape which led to the lineages of Chimpanzees and Bonobos on one hand and humans on the other. It is to be remembered that both groups have evolved in its own way for millions of years before taking the present characteristics. ,[object Object],‘Missing link’ between chimps and humans is that way absurd, because evolutionary theory does not postulate the existence of such a creature that is half human and half chimp.,[object Object]
It is generally agreed that upright posture and walking on two feet was the most important event that led to the evolution of the hominid branch.,[object Object],This led to the freeing of the hand which in turn led to the making and use of better and better tools. With tool making and the precision and co-ordination required for it, the brain capacity became an important factor for natural selection to operate. The increase in brain size followed in successive hominids reaching a culmination in Homo sapiens.,[object Object]
How do we get clues regarding bipedalism from the available fossil evidence? ,[object Object],Foramen magnum is the large hole in the underside of the skull, through which the spinal cord passes. It is found towards the back in animals that walk on all four limbs like that of the chimpanzee on the left. In the bipedal and upright animals like humans, the foramen magnum is seen much more towards the center.,[object Object]
The way bones are joined together in the pelvis and foot and the shape of the leg bones and vertebrae also give us a good idea about bipedalism.,[object Object]
The skeleton of ‘Lucy’, the famous fossil of the definitely bipedal hominid discovered by Donald Johanson in the Afar region of Ethiopia dated to be about 3.2 million years ago. On the right is a reconstruction of how Lucy would have looked like.,[object Object],Since then more remains have been unearthed of this creature named ‘Australopithecus afarensis’.,[object Object],A afarensis had a small brain size like that of the apes. This is proof that bipedalism preceded increase of brain size during evolution of the hominids.,[object Object]
3.6 million year old footprints (dated by radiometric methods) discovered by Mary Leakey in Laetoli.,[object Object],The prints are strikingly different from those of a chimpanzee, and in fact are hardly distinguishable from those of modern humans. The only known hominid fossils of that age in that location are those of Lucy and her kind, the small-brained but upright-walking hominids classified as Australopithecus afarensis. ,[object Object],While the detailed interpretation of the prints remains a matter of debate, they remain an extraordinary and fascinating fossil find, preserving a moment in prehistoric time.,[object Object]
Homo habilis existed from 2.3 million to 1.6 million years ago. It displayed human like traits not seen in earlier hominids like the shape of its upper jaw. But they retained a number of ape like characters like long arms and short legs.,[object Object],Homo habilis is believed to be one among the first tool users. ,[object Object]
Homo habilis tools were simple stone flakes with a sharp edge. They probably used these tools for cleaving meat off of dead animals rather than hunting.,[object Object]
Homo ergaster which lived 1.9 million to 1.3 million years ago had a larger brain than Homo habilis. ,[object Object],Some regard this as a subspecies of Homo erectus.,[object Object]
Homo erectus which lived from 1.8 million to less than 100000 years ago was the first human ancestor to leave Africa and reach various parts of Asia and Europe.  They had brain sizes varying fro 850cc in the older to about 1100 cc in the later specimens.,[object Object],Many consider Homo erectus to be the direct predecessor of modern humans and the Neanderthals.,[object Object]
Homo ergaster and Homo erectus made tools which were more sophisticated than the stone flakes used by Homo habilis. The tools indicate that they were definitely hunters. These type of tools called the Acheulean tools have been recovered from all over the world and had remained unchanged for nearly a million years.,[object Object]
Homo erectus was the first to have definitely used controlled fire, though whether they made fire is debatable.,[object Object]
Neanderthal and modern humans. Both spread from Africa to Europe and Asia and co-existed till about 30000 years ago when the Neanderthals disappeared. There is difference of opinion whether to regard them as two sub-species of Homo sapiens or as separate species ie. H sapiens and H neanderthalis. Both the groups had similar brain size of about 1400 cc.,[object Object]
Brain size increased progressively during hominid evolution to the 1400 cc or so in the moderns and neanderthals. ,[object Object],We have seen that bipedalism preceded increase in brain size and that resulted in freeing of hands and its it use in fine co-ordinated movements. ,[object Object],This is reflected in the anatomy of the human brain.,[object Object]
This is the human brain. Areas shown in red and blue are those concerned with voluntary  movements and their coordination.,[object Object]
See the various parts of the body represented in the motor areas of the brain according to scale. Note that about one third of the area is just for the hand. ,[object Object]
The Neanderthals were our closest cousins. They spread from Africa to the colder climates of Europe and Northern Asia earlier than us. Their body was more adapted to cold. They were stockier and had large noses and a heavy ridges on the brows.,[object Object]
Their tools were far more sophisticated than that of Homo erectus.,[object Object]
Reconstruction of how a Neanderthal girl would have looked like. We wouldn’t have recognized her in a crowd of modern humans as someone belonging to a different species.,[object Object],Did we interbreed with the Neanderthals? Current evidence from DNA isolated from  Neanderthal remains says no.,[object Object]
Both Neanderthals and modern humans buried their dead. Modern humans frequently buried other artifacts along with their dead indicating rituals.,[object Object],Here is a Homo sapiens woman and a baby buried together  in a cave in Israel some 100,000 years ago.,[object Object]
Homo sapiens tools were superior and used material like quartz. They also made new kind of tools like arrowheads.,[object Object]
One thing that seems to have set apart Homo sapiens from others is the capacity for abstract thought and expression. ,[object Object],Animal figures engraved in the Cussac cave (France) about 22000 years ago.,[object Object]
A 24000 year old sculpture of a woman’s head (France),[object Object]
The family tree of hominids spanning about 4 million years. It has branching shape some branches leading to dead ends. ,[object Object]
There have been two theories regarding the origin of modern humans ie. Homo sapiens sapiens.,[object Object],One view called the ‘Multiregional model’ is that modern humans arose separately in the different continents from the predecessor species ie. Homo erectus. ,[object Object],The second view dubbed the ‘Out of Africa model’ holds that modern humans rose in Africa and spread to rest of the world.,[object Object]
The multiregional model. The model according to some of its proponents also holds that the different races like Africans, Europeans and Asians evolved separately.,[object Object]
The ‘Out of Africa’ model,[object Object],The ‘Out of Africa’ model.  The numbers shown is the time (in years) when the earliest  fossils of modern humans have been found in different parts of the world.,[object Object]
The multiregional hypothesis by its implication of separate evolution of different races over a long duration of time has been used by racists to justify their theories. Nineteenth century textbooks used misleading imagery to suggest that "Negroes" had been created to rank between "Greeks" and chimpanzees.,[object Object]
Craniometry, the technique of measuring the bones of the skull and finding the cranial capacity was used in the nineteenth century to justify the hierarchical ordering of races with Europeans at the top and Africans at the bottom.,[object Object],These studies have now been shown to be unscientific or even fabricated in some cases.,[object Object],But such studies have been cited to support the idea that negroes had been created unequal, suited to slavery,[object Object]
Human zoos were 19th and 20th century public exhibits of human beings, usually in a "natural" or "primitive" state. The displays often emphasized the cultural differences between Western and non-European peoples. Ethnographic zoos were based on scientific racism, and a version of Social Darwinism. A number of them placed indigenous people (particularly Africans) in a continuum somewhere between the great apes and human beings of European descent. ,[object Object]
Caricature of SaartjieBaartman (1789 - 1815) who was exhibited – nearly nude – in various shows in 19th century Europe under the name Hottentot Venus. ,[object Object], Saartjie Baartman (Hottentot Venus),[object Object]
Starting from the 17th century and lasting to the nineteenth, 10 to 12 million Africans were taken to the Americas and sold in slavery.,[object Object],They were packed into ships like this like cattle. Many thousands died on the way.,[object Object]
Inhuman treatment was meted out to them. A photograph from 1863. Whipping was a common punishment in the Southern states of America.,[object Object]
Hitler and his Nazi Party published many books on scientific racism maintaining that the Aryan race was the most superior.,[object Object]
These ideas led to the concentration camps where millions perished.,[object Object]
Millions were put to death in gas chambers in camps like Auschwitz and Belsen. Their main fault was belonging to the allegedly inferior races.,[object Object]
So called scientific theories of racism was used to justify such horrors.,[object Object]
Segregation based on color of the skin was practiced as late as the second half of the twentieth century in Southern United States and South Africa.,[object Object]
In South Africa, the oppressive system of Apartheid was practiced. This was also based on theories of racial superiority and inferiority.,[object Object]
IQ,[object Object],The most recent pseudo-science is the theory of heritable racial differences in IQ. In its crudest form it states that,[object Object],General intelligence or the ’g factor’ is inherited as a simple phenotypic trait,[object Object],Determinant of IQ is predominantly genetic and environment has very little influence,[object Object],There are IQ differences between races and the blacks are inferior in this respect.,[object Object]
Books like the bell curve publlshed in 1994 still peddle these outmoded theories. They maintain that black children in America score less in IQ tests consistently and that this is due genetic reasons. ,[object Object],The political message they convey is that affirmative action and special education for black children are of no use.  ,[object Object]
 Average IQ of different racial groups residing in the United States ,[object Object],Black  		  Spanish                          White                              Asians,[object Object],The graph shows average IQ of different racial groups residing in the United States according to one study.,[object Object],Though these statistics are used to establish genetic differences in intelligence between groups, it appears prima facie fallacious. ,[object Object],The average IQ shown correlates best with the average income. It is significant that Asians have the highest average IQ. They also have the highest income since the immigrants to USA from Asia are generally better educated and contain a large number of professionals.,[object Object]
Equal light,[object Object],Adequate nutrients,[object Object],Not adequate nutrients,[object Object],Even if a trait is almost fully heritable, the group differences need not be genetic. ,[object Object],In the example shown the height of corn plants is almost 100% heritable. But there is marked difference in height between plants that get adequate nutrients and those that do not. ,[object Object]
The pseudo-scientific theories regarding racial differences and social inequality are sometimes called ‘Social Darwinism’. This is an unfortunate term since it has nothing to do with Darwinism.,[object Object],Darwin himself believed in the unity of the human species and was against polygenic theory of races. He was a staunch opponent of slavery. ,[object Object]
Let us briefly  see what current studies in molecular biology tell us about our past,[object Object]
This is a landmark paper published by Allan Wilson and colleagues in the journal Nature in 1987. They examined mitochondrial DNA variations in different human populations from all round the world.,[object Object]
Mitochondria are tiny organelles in eukaryote cells  that generate most of its chemical energy. ,[object Object]
They are believed to have originally been bacteria that colonized a proto eukaryotic cell.,[object Object]
They have their own circular DNA, which is very similar in all vertebrate cells. ,[object Object],There are 37 genes in all of them and this again is evidence of common descent. The differences between the various groups is exactly as predicted by the evolutionary relationships.,[object Object]
ATTTCGGCCTTACCGTTAAGTCCTTTTAAGT,[object Object],ATTTCGGCCTTACCATTAAGTCCTTTTAAGT,[object Object],ATTTCGGCCTTACCATTAAGTGCTTTTAAGT,[object Object],ATTTCGGCCTTACCATTAAGTGCTTTTAAGA,[object Object],The differences in the mitochondrial genes can also be used in another way. Random mutations occur in certain regions of the mitochondrial DNA ate a fixed rate. They thus serve as a sort of molecular clocks.,[object Object],This is what Allan Wilson and colleagues did in the study mentioned earlier. ,[object Object]
All the mitochondria in our cells come from our mothers. When the egg and sperm unite to form an embryo the few mitochondria present in the sperm is lost and only those in the egg are passed onto the baby.,[object Object],So all the mitochondrial DNA that each of us have belongs to our mothers.,[object Object]
My mitochondrial DNA comes from my mother. Hers from her mother and so on. Five generations back I would have had a maximum of 32 ancestors – 16 men and 16 women. But of these all my mitochondrial DNA would have come fro a single woman.,[object Object]
If there are 3 billion women in the world today, the number of their female ancestors in the previous generation would have been less than that number, since some would have had more than one daughter. If we go back in time long enough, the female ancestor of all living women today would be only one.,[object Object]
So all of us living in this world today have inherited our mitochondrial DNA from a woman who lived about 160000 years ago in Africa. Studies done by different people using the molecular clock concept agree on this, though the time estimate varies from about 1 to 2 lakh years.,[object Object],It is to be noted that we have not inherited all our genes from this woman. For each gene the convergence may be to a different ancestor.,[object Object],In that sense use of the term ‘Eve’ is inappropriate. ,[object Object]
When mitochondrial DNA sequences from people living in different parts of the world are studied, they can be divided into different groups. They are named L, M, N etc. Depending on the mutation patterns it can be inferred which group followed which. For example L is the most ancient, additional mutations in the sequence gives rise to M, more mutations to N etc. ,[object Object],By looking at the predominant group found among indigenous people in each area, the patterns of migration can be inferred.,[object Object],Such studies unmistakably point to Africa as the cradle of the human species.,[object Object]
Y chromosome is the smallest chromosome. It is seen only in males,[object Object],Y chromosome,[object Object]
Y chromosome is inherited from father to son. Similar to what we have seen in case of mitochondrial DNA, the Y chromosome of every male in the world today can be traced back to a single male ancestor in the remote past.,[object Object],And by studying the mutation patterns in the Y chromosome, it can be estimated how long ago that ancestor lived. It is further possible to study the migration patterns of humans using this tool just as in the case of the mitochondrial DNA.,[object Object]
All current evidence point to a man in Africa who lived around 60000 to 90000 years back as our Y chromosome ancestor. ,[object Object],Needless to say the rest of our genes may be traced to other ancestors and so the term Adam is again inappropriate.,[object Object]
Migration patterns established by studying the mutations in Y chromosome DNA again unequivocally proves our African origin. ,[object Object]
Because of the popular usage of terms like mitochondrial Eve and Y-chromosome Adam it may be confusing when we say that this Adam and Eve may have lived in different times. In fact every one of our genes will converge on a different ancestor in the past.,[object Object],But we can say with some degree of confidence that all of us, without exception have descended from a rather small band of modern humans in Africa sometime around 200000 years ago. ,[object Object],      Adam and Eve might not have met,[object Object]
This means that we human beings are a very young species. Only about 7500 generations separate us from the first band of modern humans in Africa. ,[object Object],This means that the differences between all human beings are only the equivalent of the changes that occur in a species of bacteria in a period of 2 months.,[object Object],The differences amongst are cultural rather than genetic.,[object Object]
Sewall Wright was a pioneer in population genetics. He evolved a measure called Fixation Index (FST) which is a measure of population differentiation based on genetic polymorphism data.,[object Object],According to him, if within a species the FST is more than 0.25 between two groups, then it can be called a separate sub-species or races.,[object Object]
The differences between human beings based on various genes is only about 0.1.,[object Object],To talk of races among Homo sapiens is thus scientifically invalid.,[object Object]
We are misled by the differences in rapidly evolving traits like skin color into imagining bigger differences between human beings than what actually exists.,[object Object],Race in human beings is only skin deep.,[object Object]
Human oneness and equality are not mere ethical concepts. It is true.,[object Object]

Weitere ähnliche Inhalte

Was ist angesagt?

Evolution from apes to humans, s. mubasher
Evolution from apes to humans, s. mubasherEvolution from apes to humans, s. mubasher
Evolution from apes to humans, s. mubasherMubasher Solangi
 
Human Evolution - The drastic change
Human Evolution - The drastic changeHuman Evolution - The drastic change
Human Evolution - The drastic changeKumarlalit750
 
Human evolution
Human evolutionHuman evolution
Human evolutionAkumpaul
 
Evolution of Man
Evolution of ManEvolution of Man
Evolution of Manivy_thinks
 
The Emergence Of Homo Sapiens
The Emergence Of Homo SapiensThe Emergence Of Homo Sapiens
The Emergence Of Homo SapiensZea Siona
 
Human Evolution - a notebook
Human Evolution - a notebookHuman Evolution - a notebook
Human Evolution - a notebookRoberto Sáez
 
Research project - human evolution
Research project -  human evolutionResearch project -  human evolution
Research project - human evolutiontbutle
 
Evolution of man(palaeontological evidence)
Evolution of man(palaeontological evidence)Evolution of man(palaeontological evidence)
Evolution of man(palaeontological evidence)Vinay c
 
Human evolution
Human evolutionHuman evolution
Human evolutionmaricalvhi
 
Australopithecus
AustralopithecusAustralopithecus
AustralopithecusBachicmc1A
 
Neanderthal
NeanderthalNeanderthal
Neanderthalmorais90
 
Homo sapiens sapiens
Homo sapiens sapiensHomo sapiens sapiens
Homo sapiens sapiensBachicmc1A
 
Ch. 15 Hominin Evolution
Ch. 15  Hominin EvolutionCh. 15  Hominin Evolution
Ch. 15 Hominin EvolutionMartin Jellinek
 

Was ist angesagt? (20)

Evolution from apes to humans, s. mubasher
Evolution from apes to humans, s. mubasherEvolution from apes to humans, s. mubasher
Evolution from apes to humans, s. mubasher
 
Neanderthals powerpoint
Neanderthals powerpointNeanderthals powerpoint
Neanderthals powerpoint
 
Human Evolution - The drastic change
Human Evolution - The drastic changeHuman Evolution - The drastic change
Human Evolution - The drastic change
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Evolution of Man
Evolution of ManEvolution of Man
Evolution of Man
 
Human Evolution
Human EvolutionHuman Evolution
Human Evolution
 
4.human evolution
4.human  evolution4.human  evolution
4.human evolution
 
The Emergence Of Homo Sapiens
The Emergence Of Homo SapiensThe Emergence Of Homo Sapiens
The Emergence Of Homo Sapiens
 
Unit 6 human evolution a
Unit 6 human evolution aUnit 6 human evolution a
Unit 6 human evolution a
 
Human Evolution - a notebook
Human Evolution - a notebookHuman Evolution - a notebook
Human Evolution - a notebook
 
Research project - human evolution
Research project -  human evolutionResearch project -  human evolution
Research project - human evolution
 
Evolution of man(palaeontological evidence)
Evolution of man(palaeontological evidence)Evolution of man(palaeontological evidence)
Evolution of man(palaeontological evidence)
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Australopithecus
AustralopithecusAustralopithecus
Australopithecus
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Neanderthal
NeanderthalNeanderthal
Neanderthal
 
Human Evolution
Human EvolutionHuman Evolution
Human Evolution
 
Homo sapiens sapiens
Homo sapiens sapiensHomo sapiens sapiens
Homo sapiens sapiens
 
Neanderthals, Lecture 9
Neanderthals, Lecture 9Neanderthals, Lecture 9
Neanderthals, Lecture 9
 
Ch. 15 Hominin Evolution
Ch. 15  Hominin EvolutionCh. 15  Hominin Evolution
Ch. 15 Hominin Evolution
 

Andere mochten auch

Human Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint PresentationHuman Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint Presentationsanfojam
 
Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.PaulVMcDowell
 
Payton_EarlyHumanTools
Payton_EarlyHumanToolsPayton_EarlyHumanTools
Payton_EarlyHumanToolsMs Wilson
 
Groups of Hominids
Groups of HominidsGroups of Hominids
Groups of HominidsA Lecesse
 
Bronze age Ireland
Bronze age IrelandBronze age Ireland
Bronze age IrelandNoel Hogan
 
Human evolution
Human evolutionHuman evolution
Human evolution11
 
Bhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifeBhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifePatnaik Gourishankar
 
Tools used by early people
Tools used by early peopleTools used by early people
Tools used by early peopleMs Wilson
 
A2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionA2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionmissfcmay
 
Evolution By Stages
Evolution By StagesEvolution By Stages
Evolution By StagesGeorginaP14
 
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartups
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartupsLEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartups
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartupsRod King, Ph.D.
 

Andere mochten auch (20)

Human Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint PresentationHuman Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint Presentation
 
Cells
CellsCells
Cells
 
Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.
 
Sun & moon
Sun & moonSun & moon
Sun & moon
 
Payton_EarlyHumanTools
Payton_EarlyHumanToolsPayton_EarlyHumanTools
Payton_EarlyHumanTools
 
Groups of Hominids
Groups of HominidsGroups of Hominids
Groups of Hominids
 
Bronze age Ireland
Bronze age IrelandBronze age Ireland
Bronze age Ireland
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Bhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifeBhagwat gita …..and origin of life
Bhagwat gita …..and origin of life
 
Homo Zappiens
Homo ZappiensHomo Zappiens
Homo Zappiens
 
Tools used by early people
Tools used by early peopleTools used by early people
Tools used by early people
 
The Bronze Age
The Bronze AgeThe Bronze Age
The Bronze Age
 
A2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionA2 exam 2014 growth and evolution
A2 exam 2014 growth and evolution
 
Darwins theory final
Darwins theory finalDarwins theory final
Darwins theory final
 
Evolution by stages
Evolution by stagesEvolution by stages
Evolution by stages
 
What about Adam and Eve
What about Adam and EveWhat about Adam and Eve
What about Adam and Eve
 
bronze age
bronze agebronze age
bronze age
 
Bronze age
Bronze ageBronze age
Bronze age
 
Evolution By Stages
Evolution By StagesEvolution By Stages
Evolution By Stages
 
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartups
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartupsLEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartups
LEAN STARTUP LIFECYCLE: 5 Stages in the Evolution of Billion Dollar $tartups
 

Ähnlich wie Human Evolution

Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Riverside County Office of Education
 
Neanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryNeanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryChristina Valadez
 
Ardipithecus Ramidus
Ardipithecus RamidusArdipithecus Ramidus
Ardipithecus RamidusLinda Gosnell
 
Life And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyLife And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyAshley Davis
 
Similarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesSimilarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesLissette Hartman
 
Australopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAustralopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAmber Moore
 
Paranthropus Boisei
Paranthropus BoiseiParanthropus Boisei
Paranthropus BoiseiSharon Lee
 
Homo Sapiens Thesis
Homo Sapiens ThesisHomo Sapiens Thesis
Homo Sapiens ThesisAshley Smith
 
Conflict Between The Multiple Theories Of Bipedalism
Conflict Between The Multiple Theories Of BipedalismConflict Between The Multiple Theories Of Bipedalism
Conflict Between The Multiple Theories Of BipedalismJessica Moore
 
Kate early man ppt
Kate early man pptKate early man ppt
Kate early man pptMs Wilson
 
The Earth Has Never Stopped Revolving Ever Since It Had...
The Earth Has Never Stopped Revolving Ever Since It Had...The Earth Has Never Stopped Revolving Ever Since It Had...
The Earth Has Never Stopped Revolving Ever Since It Had...Meghan Howard
 
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
MUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docxMUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docx
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docxroushhsiu
 
Understanding Our Past
Understanding Our PastUnderstanding Our Past
Understanding Our Pastpbrock
 
Unit 5 prehistory theory
Unit 5 prehistory theoryUnit 5 prehistory theory
Unit 5 prehistory theorysergio.historia
 

Ähnlich wie Human Evolution (20)

Evolution of Human
Evolution of HumanEvolution of Human
Evolution of Human
 
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
 
Neanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryNeanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien Theory
 
Ardipithecus Ramidus
Ardipithecus RamidusArdipithecus Ramidus
Ardipithecus Ramidus
 
Life And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyLife And Discoveries Of Louis Leakey
Life And Discoveries Of Louis Leakey
 
Similarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesSimilarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And Chimpanzees
 
26-3 PowerPoint.ppt
26-3 PowerPoint.ppt26-3 PowerPoint.ppt
26-3 PowerPoint.ppt
 
Australopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAustralopithecus Cordi Human Evolution
Australopithecus Cordi Human Evolution
 
Paranthropus Boisei
Paranthropus BoiseiParanthropus Boisei
Paranthropus Boisei
 
Homo Sapiens Thesis
Homo Sapiens ThesisHomo Sapiens Thesis
Homo Sapiens Thesis
 
GROUP-3-UCSP.pptx
GROUP-3-UCSP.pptxGROUP-3-UCSP.pptx
GROUP-3-UCSP.pptx
 
Conflict Between The Multiple Theories Of Bipedalism
Conflict Between The Multiple Theories Of BipedalismConflict Between The Multiple Theories Of Bipedalism
Conflict Between The Multiple Theories Of Bipedalism
 
Kate early man ppt
Kate early man pptKate early man ppt
Kate early man ppt
 
An article on human evolution
 An article on human evolution An article on human evolution
An article on human evolution
 
H. Erectus Essay
H. Erectus EssayH. Erectus Essay
H. Erectus Essay
 
The Earth Has Never Stopped Revolving Ever Since It Had...
The Earth Has Never Stopped Revolving Ever Since It Had...The Earth Has Never Stopped Revolving Ever Since It Had...
The Earth Has Never Stopped Revolving Ever Since It Had...
 
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
MUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docxMUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docx
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
 
Understanding Our Past
Understanding Our PastUnderstanding Our Past
Understanding Our Past
 
Fossil Mosaic Evolution
Fossil Mosaic EvolutionFossil Mosaic Evolution
Fossil Mosaic Evolution
 
Unit 5 prehistory theory
Unit 5 prehistory theoryUnit 5 prehistory theory
Unit 5 prehistory theory
 

Mehr von THANKACHAN V P

Mehr von THANKACHAN V P (20)

KERALA SASTRA SAHITHYA PARISHATH
KERALA SASTRA SAHITHYA PARISHATHKERALA SASTRA SAHITHYA PARISHATH
KERALA SASTRA SAHITHYA PARISHATH
 
GREEN KERALA
GREEN KERALAGREEN KERALA
GREEN KERALA
 
ELEPHANT RACE GURUVAYOOR
ELEPHANT RACE GURUVAYOORELEPHANT RACE GURUVAYOOR
ELEPHANT RACE GURUVAYOOR
 
My lady of dreams
My lady of dreamsMy lady of dreams
My lady of dreams
 
Iya Activities Of Kssp
Iya Activities Of KsspIya Activities Of Kssp
Iya Activities Of Kssp
 
Science Tour On Wheels
Science Tour On WheelsScience Tour On Wheels
Science Tour On Wheels
 
Traditional Marriage
Traditional MarriageTraditional Marriage
Traditional Marriage
 
Evolutionary Theory in 21st Century
Evolutionary Theory in 21st CenturyEvolutionary Theory in 21st Century
Evolutionary Theory in 21st Century
 
International Year Of Astronomy
International Year Of AstronomyInternational Year Of Astronomy
International Year Of Astronomy
 
India Election 2009
India Election 2009India Election 2009
India Election 2009
 
Study tour to Lakshadweep Islands
Study tour to Lakshadweep IslandsStudy tour to Lakshadweep Islands
Study tour to Lakshadweep Islands
 
To The Medical Student
To The Medical Student To The Medical Student
To The Medical Student
 
ONAM-THE FESTIVAL OF FLOWERS
ONAM-THE FESTIVAL OF FLOWERSONAM-THE FESTIVAL OF FLOWERS
ONAM-THE FESTIVAL OF FLOWERS
 
Race Boat India 1
Race Boat India  1Race Boat India  1
Race Boat India 1
 
Kathakali
KathakaliKathakali
Kathakali
 
Pooram 1
Pooram 1Pooram 1
Pooram 1
 
Asha Poorna
Asha PoornaAsha Poorna
Asha Poorna
 
In The Name Of God
In The Name Of GodIn The Name Of God
In The Name Of God
 
Theyyam
TheyyamTheyyam
Theyyam
 
Silent Valley Pps
Silent Valley PpsSilent Valley Pps
Silent Valley Pps
 

Kürzlich hochgeladen

UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8DianaGray10
 
Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024D Cloud Solutions
 
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...Aggregage
 
AI You Can Trust - Ensuring Success with Data Integrity Webinar
AI You Can Trust - Ensuring Success with Data Integrity WebinarAI You Can Trust - Ensuring Success with Data Integrity Webinar
AI You Can Trust - Ensuring Success with Data Integrity WebinarPrecisely
 
UiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPathCommunity
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfDaniel Santiago Silva Capera
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostMatt Ray
 
Cybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxCybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxGDSC PJATK
 
Computer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsComputer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsSeth Reyes
 
NIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopNIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopBachir Benyammi
 
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDEADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDELiveplex
 
Building Your Own AI Instance (TBLC AI )
Building Your Own AI Instance (TBLC AI )Building Your Own AI Instance (TBLC AI )
Building Your Own AI Instance (TBLC AI )Brian Pichman
 
Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.YounusS2
 
UiPath Studio Web workshop series - Day 6
UiPath Studio Web workshop series - Day 6UiPath Studio Web workshop series - Day 6
UiPath Studio Web workshop series - Day 6DianaGray10
 
20230202 - Introduction to tis-py
20230202 - Introduction to tis-py20230202 - Introduction to tis-py
20230202 - Introduction to tis-pyJamie (Taka) Wang
 
Salesforce Miami User Group Event - 1st Quarter 2024
Salesforce Miami User Group Event - 1st Quarter 2024Salesforce Miami User Group Event - 1st Quarter 2024
Salesforce Miami User Group Event - 1st Quarter 2024SkyPlanner
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Websitedgelyza
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UbiTrack UK
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAshyamraj55
 

Kürzlich hochgeladen (20)

UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8
 
Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024
 
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...
The Data Metaverse: Unpacking the Roles, Use Cases, and Tech Trends in Data a...
 
AI You Can Trust - Ensuring Success with Data Integrity Webinar
AI You Can Trust - Ensuring Success with Data Integrity WebinarAI You Can Trust - Ensuring Success with Data Integrity Webinar
AI You Can Trust - Ensuring Success with Data Integrity Webinar
 
UiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation Developers
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
 
Cybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxCybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptx
 
Computer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsComputer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and Hazards
 
NIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopNIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 Workshop
 
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDEADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
 
20150722 - AGV
20150722 - AGV20150722 - AGV
20150722 - AGV
 
Building Your Own AI Instance (TBLC AI )
Building Your Own AI Instance (TBLC AI )Building Your Own AI Instance (TBLC AI )
Building Your Own AI Instance (TBLC AI )
 
Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.
 
UiPath Studio Web workshop series - Day 6
UiPath Studio Web workshop series - Day 6UiPath Studio Web workshop series - Day 6
UiPath Studio Web workshop series - Day 6
 
20230202 - Introduction to tis-py
20230202 - Introduction to tis-py20230202 - Introduction to tis-py
20230202 - Introduction to tis-py
 
Salesforce Miami User Group Event - 1st Quarter 2024
Salesforce Miami User Group Event - 1st Quarter 2024Salesforce Miami User Group Event - 1st Quarter 2024
Salesforce Miami User Group Event - 1st Quarter 2024
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Website
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
 

Human Evolution

  • 1.
  • 2.
  • 3.
  • 4.
  • 5.
  • 6.
  • 7.
  • 8.
  • 9.
  • 10.
  • 11.
  • 12.
  • 13.
  • 14.
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.
  • 21.
  • 22.
  • 23.
  • 24.
  • 25.
  • 26.
  • 27.
  • 28.
  • 29.
  • 30.
  • 31.
  • 32.
  • 33.
  • 34.
  • 35.
  • 36.
  • 37.
  • 38.
  • 39.
  • 40.
  • 41.
  • 42.
  • 43.
  • 44.
  • 45.
  • 46.
  • 47.
  • 48.
  • 49.
  • 50.
  • 51.
  • 52.
  • 53.
  • 54.
  • 55.
  • 56.
  • 57.
  • 58.
  • 59.
  • 60.
  • 61.
  • 62.
  • 63.
  • 64.
  • 65.
  • 66.
  • 67.
  • 68.
  • 69.
  • 70.
  • 71.
  • 72.
  • 73.
  • 74.
  • 75.