1. Scaling up genomic
analysis with ADAM
Frank Austin Nothaft, UC Berkeley AMPLab
fnothaft@berkeley.edu, @fnothaft
10/27/2014
2. What is ADAM?
• An open source, high performance, distributed
platform for genomic analysis
• ADAM defines a:
1. Data schema and layout on disk*
2. A Scala API
3. A command line interface
* Via Avro and Parquet
3. What’s the big picture?
ADAM:!
Core API +
CLIs
bdg-formats:!
Data schemas
RNAdam:!
RNA analysis on
ADAM
avocado:!
Distributed local
assembler
xASSEMBLEx:!
GraphX-based de
novo assembler
bdg-services:!
ADAM clusters
PacMin:!
String graph
assembler
4. Implementation Overview
• 34k LOC (96% Scala)
• Apache 2 licensed OSS
• 23 contributors across 10 institutions
• Pushing for production 1.0 release towards end of year
5. Key Observations
• Current genomics pipelines are I/O limited
• Most genomics algorithms can be formulated as a
data or graph parallel computation
• These algorithms are heavy on iteration/pipelining
• Data access pattern is write once, read many times
• High coverage, whole genome will become main
sequencing target (for human genetics)
6. Principles for Scalable
Design in ADAM
• Parallel FS and data representation (HDFS +
Parquet) combined with in-memory computing
eliminates disk bandwidth bottleneck
• Spark allows efficient implementation of iterative/
pipelined Map-Reduce
• Minimize data movement: send code to data
7. • An in-memory data parallel computing framework
• Optimized for iterative jobs —> unlike Hadoop
• Data maintained in memory unless inter-node
movement needed (e.g., on repartitioning)
• Presents a functional programing API, along with
support for iterative programming via REPL
• Used at scale on clusters with >2k nodes, 4TB
datasets
8. Why Spark?
• Current leading map-reduce framework:
• First in-memory map-reduce platform
• Used at scale in industry, supported in major distros (Cloudera,
HortonWorks, MapR)
• The API:
• Fully functional API
• Main API in Scala, also support Java, Python, R
• Manages node/job failures via lineage, data locality/job assignment
• Downstream tools (GraphX, MLLib)
9. Data Format
• Avro schema encoded by
Parquet
• Schema can be updated
without breaking backwards
compatibility
• Read schema looks a lot like
BAM, but renormalized
• Actively removing tags
• Variant schema is strictly
biallelic, a “cell in the matrix”
record AlignmentRecord {
union { null, Contig } contig = null;
union { null, long } start = null;
union { null, long } end = null;
union { null, int } mapq = null;
union { null, string } readName = null;
union { null, string } sequence = null;
union { null, string } mateReference = null;
union { null, long } mateAlignmentStart = null;
union { null, string } cigar = null;
union { null, string } qual = null;
union { null, string } recordGroupName = null;
union { int, null } basesTrimmedFromStart = 0;
union { int, null } basesTrimmedFromEnd = 0;
union { boolean, null } readPaired = false;
union { boolean, null } properPair = false;
union { boolean, null } readMapped = false;
union { boolean, null } mateMapped = false;
union { boolean, null } firstOfPair = false;
union { boolean, null } secondOfPair = false;
union { boolean, null } failedVendorQualityChecks = false;
union { boolean, null } duplicateRead = false;
union { boolean, null } readNegativeStrand = false;
union { boolean, null } mateNegativeStrand = false;
union { boolean, null } primaryAlignment = false;
union { boolean, null } secondaryAlignment = false;
union { boolean, null } supplementaryAlignment = false;
union { null, string } mismatchingPositions = null;
union { null, string } origQual = null;
union { null, string } attributes = null;
union { null, string } recordGroupSequencingCenter = null;
union { null, string } recordGroupDescription = null;
union { null, long } recordGroupRunDateEpoch = null;
union { null, string } recordGroupFlowOrder = null;
union { null, string } recordGroupKeySequence = null;
union { null, string } recordGroupLibrary = null;
union { null, int } recordGroupPredictedMedianInsertSize = null;
union { null, string } recordGroupPlatform = null;
union { null, string } recordGroupPlatformUnit = null;
union { null, string } recordGroupSample = null;
union { null, Contig} mateContig = null;
}
10. Parquet
• ASF Incubator project, based on
Google Dremel
• http://www.parquet.io
• High performance columnar
store with support for projections
and push-down predicates
• 3 layers of parallelism:
• File/row group
• Column chunk
• Page
Image from Parquet format definition: https://github.com/Parquet/parquet-format
11. Filtering
• Parquet provides pushdown predication
• Evaluate filter on a subset of columns
• Only read full set of projected columns for passing records
• Full primary/secondary indexing support in Parquet 2.0
• Very efficient if reading a small set of columns:
• On disk, contig ID/start/end consume < 2% of space
Image from Parquet format definition: https://github.com/Parquet/parquet-format
12. Compression
• Parquet compresses
at the column level:
• RLE for repetitive
columns
• Dictionary
encoding for
quantized
columns
• ADAM uses a fully
denormalized schema
• Repetitive columns are
RLE’d out
• Delta encoding
(Parquet 2.0) will aid
with quality scores
• ADAM is 5-25% smaller
than compressed BAM
13. Parquet/Spark Integration
• 1 row group in Parquet maps
to 1 partition in Spark
• We interact with Parquet via
input/output formats
• These apply projections
and predicates, handle
(de)compression
• Spark builds and executes a
computation DAG, manages
data locality, errors/retries, etc.
Parquet
RG 1 RG 2 RG n …
Spark
Parquet Input Format
Partition
2
…
Parquet Output Format
Parquet
Partition
1
Partition
n
RG 1 RG 2 RG n …
15. The State of Analysis
• Conventional short-read alignment based pipelines
are really good at calling SNPs
• But, we’re still pretty bad at calling INDELs, and
SVs
• And are slow: 2 weeks to sequence, 1 week to
analyze. Not fast enough for clinical use.
• If we move away from short reads, do we have other
options?
16. Opportunities
• New read technologies are available
• Provide much longer reads (250bp vs. >10kbp)
• Different error model… (15% INDEL errors, vs. 2%
SNP errors)
• Generally, lower sequence specific bias
Left: PacBio homepage, Right: Wired, http://www.wired.com/2012/03/oxford-nanopore-sequencing-usb/
17. If long reads are available…
• We can use conventional methods:
Carneiro et al, Genome Biology 2012
18. But!
• Why not make raw assemblies out of the reads?
Find overlapping reads Find consensus sequence
for all pairs of reads (i,j):
i j
=?
…ACACTGCGACTCATCGACTC…
• Problems:
1. Overlapping is O(n
2
) and single evaluation is expensive anyways
2. Typical algorithms find a single consensus sequence; what if we’ve got
polymorphisms?
19. Fast Overlapping with
MinHashing
• Wonderful realization by Berlin et al1: overlapping is
similar to document similarity problem
• Use MinHashing to approximate similarity:
1: Berlin et al, bioRxiv 2014
Per document/read,
compute signature:!
!
1. Cut into shingles
2. Apply random
hashes to shingles
3. Take min over all
random hashes
Hash into buckets:!
!
Signatures of length l
can be hashed into b
buckets, so we expect
to compare all elements
with similarity
≥ (1/b)^(b/l)
Compare:!
!
For two documents with
signatures of length l,
Jaccard similarity is
estimated by
(# equal hashes) / l
!
• Easy to implement in Spark: map, groupBy, map, filter
20. Overlaps to Assemblies
• Finding pairwise overlaps gives us a directed
graph between reads (lots of edges!)
21. Transitive Reduction
• We can find a consensus between clique members
• Or, we can reduce down:
• Via two iterations of Pregel!
22. Actually Making Calls
• From here, we need to call copy number per edge
• Probably via Newton-Raphson based on coverage; we’re not sure yet.
• Then, per position in each edge, call alleles:
Notes:!
Equation is from Li, Bioinformatics 2011
g = genotype state
m = ploidy
휖 = probability allele was erroneously observed
k = number of reads observed
l = number of reads observed matching “reference” allele
TBD: equation assumes biallelic observations at site and reference allele; we won’t have either of those conveniences…
23. An aside: Monoallelic
Genotyping
• Traditional probabilistic models for variant calling
assume independence at each site
• However, this throws away a lot of information
• Can consider a different formulation of the problem:
• Build a graph of the alleles
• Find the allelic copy numbers that maximize
likelihood
25. Allelic Graph
ACACTCG
C
A
TCTCA
G
C
TCCACACT
• Edges of graph define conditional probabilities
• E.g., if ACACTCG is covered by 30 reads, and
C is covered by 1 read, P(C | ACACTCG) is low
• Can efficiently marginalize probabilities over graph
using Eliminate algorithm1, exactly solve for argmax
1. Jordan, “Probabilistic Graphical Models.”
26. Output
• Current assemblers emit FASTA contigs
• In layperson’s speak: long strings
• We’ll emit “multigs”, which we’ll map back to reference
graph
• Multig = multi-allelic (polymorphic) contig
• Working with UCSC, who’ve done some really neat work1
deriving formalisms & building software for mapping
between sequence graphs, and GA4GH ref. variation team
1. Paten et al, “Mapping to a Reference Genome Structure”, arXiv 2014.
27. Acknowledgements
• UC Berkeley: Matt Massie, André Schumacher,
Jey Kottalam, Christos Kozanitis, Adam Bloniarz!
• Mt. Sinai: Arun Ahuja, Neal Sidhwaney, Michael
Linderman, Jeff Hammerbacher!
• GenomeBridge: Timothy Danford, Carl Yeksigian!
• Cloudera: Uri Laserson!
• Microsoft Research: Jeremy Elson, Ravi Pandya!
• And many other open source contributors: 23
contributors to ADAM/BDG from >10 institutions